In the grand scheme of things, I doubt that the incidence of genetic defects in commercial cattle will rise above the normal "noise" level for calf or cow loss. Very few actually linebreed and as most bull suppliers are now cutting carriers from whatever breed, changing out bulls will take care of it at that level.
TH is now a commercial problem
- Thread starter yuppiecowboy
- Start date
Help Support Steer Planet:
aj
Well-known member
The stuff won't go away. Its always a 50% to pass it on. The thing about th is that the carriers are phenotypically superier so those genetics were always the first to be propagated.
Show Heifer
Well-known member
- Joined
- Jan 28, 2007
- Messages
- 2,221
Would it be impolite to say "Duh. Of course the way genetic defects are handled by some breeders it was going to show up in commercial herds." And yes, it is everyones fault who sells carriers to unknowing buyers, including those the dump them at salebarns without revealing their defective status. Do you not think if the buyer gets screwed long enough and hard enough they will not trace those cattle back to you? How do you think they will look at you? And then you will blame them for bad mouthing you and your cattle when it was all your fault to begin with. nice. real nice.
I guess all of "us alarmist, sky is falling" folks were fortune tellers huh?
I guess all of "us alarmist, sky is falling" folks were fortune tellers huh?
Doc
Well-known member
DL said:
Hey DL. good to read from you!
As far as Improver goes , him & 57th are the 2 that linked are to it thru registered cattle as the beginning, but if you talk to old timers they will tell you it comes from the Belted Galloway in Improver.
simtal
Well-known member
chambero said:
I agree. Genetic improvement is primarily due to sire, due to greater turnover and the number of progeny produced. While sire and dam each contribute 50 percent to the genetic makeup of each calf, one-half of a dam's contribution to her calf comes from her sire and one-fourth comes from her dam's sire. In most commercial herds, 87.5% of a calf's genetic material comes from the last three sires that were used in the herd.
red
Well-known member
I agree on not selling carriers without notifying buyer of status. However think of all that were sold before knowledge of defects & before tests were available.
I'm not sure how you could regulate what a buyer does w/ the cattle they buy at the sale barn even after telling status.
Red
I'm not sure how you could regulate what a buyer does w/ the cattle they buy at the sale barn even after telling status.
Red
aj
Well-known member
When did the Angus really get to be popular. Late 90's maybe. Was it the CAB beef program that really did it. I have said before that if the angus cattle have genetic defect problems, and if the various balancer programs have a problem in 10 years will it hit the fan in the commercial herds? Once you get to this point it is way to late to do anything. The solution is obvious...in ten years people will have to use red hided cattle to stay away from problems. Again...the St Louis Lad bull in the Herford breed was born in the late 1880's. The dwarfism deal wasn't figured out till the 1950's and it was to late. The breed was saturated. It could be argued that it temporarily killed the breeds popularity. Dna testing back then though was not available.
justintime
Well-known member
Doc is correct in his statement in that there may be some Galloway blood way back in the Improver line. When Dr Beever and several others were trying to trace back the lineage of the origin of TH, they hit a dead end when they got back to Improver. I was talking with Dr Beever one day about this, and he said it was really strange that the exact same defect would appear in two seperate breeds. The Galloway breed had TH back in the 60s and 70s. When Dr. Beever told me this, I related a conversation I had several years earlier with Kevin Culhane from Ireland.
In this conversation with Kevin, we had been talking about the Deerpark herd and that they had been a closed herd for many years prior to the sire of Improver arriving. I asked Kevin where the Quanes had got the sire of Improver, and he said that they had purchased him from the local sale barn. ( you have to remember that at this time, very few of the Irish cattle had registration papers and many had not been registered for many generations). When I told this story to Dr. Beever, he immediately replied that his guess was that Improver's sire went back to Galloway bloodlines somewhere in his background. I had wondered about this as well, ever since TH had appeared in the Shorthorn breed. Of course , there is no way to scientifically prove this seeing all these cattle are long dead, but it does make some sense to the exact same defect appearing. It also seems to me, to maybe also explain where all the hair some of these cattle have comes from. Some TH carrier cattle have hair in the extreme. Nothing to prove that as well, but again it does seem to lean towards some logical answer.
In this conversation with Kevin, we had been talking about the Deerpark herd and that they had been a closed herd for many years prior to the sire of Improver arriving. I asked Kevin where the Quanes had got the sire of Improver, and he said that they had purchased him from the local sale barn. ( you have to remember that at this time, very few of the Irish cattle had registration papers and many had not been registered for many generations). When I told this story to Dr. Beever, he immediately replied that his guess was that Improver's sire went back to Galloway bloodlines somewhere in his background. I had wondered about this as well, ever since TH had appeared in the Shorthorn breed. Of course , there is no way to scientifically prove this seeing all these cattle are long dead, but it does make some sense to the exact same defect appearing. It also seems to me, to maybe also explain where all the hair some of these cattle have comes from. Some TH carrier cattle have hair in the extreme. Nothing to prove that as well, but again it does seem to lean towards some logical answer.
shortyjock89
Well-known member
JIT- I had a conversation much like yours with Dr. B on one of my visits to his lab last year (it was two blocks from my dorm). I was actually just telling my dad about the possibility of Galloway blood in the Improver lines, and we talked about Irish Shorthorns, and he couldn't believe the lack of record keeping in such a modern era. Kinda crazy that it comes up on SP the next day.
CAB
Well-known member
Interesting as usual Grant. Was Dr. Beever inclined to go back as far as possible to try to find a sample of semen or DNA to see if the Galloway blood did or would show up? How are Belted Galloway tied to Galloway?
justintime
Well-known member
Belted Galloway are just a part of the Galloway breed. Galloway cattle come in Black Dun, Belted and an occasional white. The breed was developed in Scotland and there obviously is Shorthorn blood in the make-up of the breed.
Justin.. in regards to the lack of record keeping, you have to remember that these were unregistered cattle. The Quane's Deerpark herd had only used bulls from their own herd since the 1940s when they disagreed with where the Shorthorn breed was going with their belt buckle cattle of that era. They simply kept their own bulls and eventually quit registering them as well. They only sold breeding stock to a few local herds, who again kept unregistered stock.
The story goes that the Quane's were attending a local auction mart one day when a red bull calf entered the sale ring. They liked the looks of him, and bought him that day. They used him on a few cows and that is where Deerpark Improver came from. When the Irish government decided to design a program to document some of these grade Irish Shorthorns, and provide registration status to them, the sire of Improver had no name, so the Quane's suggested he be named Clare Man, as he had been purchased in the County Clare auction.
As a side note, this registry was just being started in Ireland, when Dick Judy ( Beef Genetics Research Inc) in Kansas imported the first Irish Shorthorns into the US. We brought in Highfield Irish Mist and two females the following year and they were unregistered cattle as well. We decided to do this simply because we saw things in these cattle that could help our cattle at the time. While some of the Irish cattle were way to extreme for any era, some others had some very unique traits. We decided to import these cattle, as we thought they would do three things to improve our Shorthorns at the time. These were: 1) they would improve the hip structure ... Some of the Irish cattle were extremely wide from hook to pin; 2) they would greatly improve testicles in the males... at the time, many Shorthorns had issues with twisted testicles and poor scrotum shape and 3) improve the frame and overall muscle structure of our cattle. I think the good Irish cattle that were imported did do this. Unfortunately, once the Irish craze started, most anything was imported here and some of them were not worth the trip over. Many others left a major mark on the breed.
Justin.. in regards to the lack of record keeping, you have to remember that these were unregistered cattle. The Quane's Deerpark herd had only used bulls from their own herd since the 1940s when they disagreed with where the Shorthorn breed was going with their belt buckle cattle of that era. They simply kept their own bulls and eventually quit registering them as well. They only sold breeding stock to a few local herds, who again kept unregistered stock.
The story goes that the Quane's were attending a local auction mart one day when a red bull calf entered the sale ring. They liked the looks of him, and bought him that day. They used him on a few cows and that is where Deerpark Improver came from. When the Irish government decided to design a program to document some of these grade Irish Shorthorns, and provide registration status to them, the sire of Improver had no name, so the Quane's suggested he be named Clare Man, as he had been purchased in the County Clare auction.
As a side note, this registry was just being started in Ireland, when Dick Judy ( Beef Genetics Research Inc) in Kansas imported the first Irish Shorthorns into the US. We brought in Highfield Irish Mist and two females the following year and they were unregistered cattle as well. We decided to do this simply because we saw things in these cattle that could help our cattle at the time. While some of the Irish cattle were way to extreme for any era, some others had some very unique traits. We decided to import these cattle, as we thought they would do three things to improve our Shorthorns at the time. These were: 1) they would improve the hip structure ... Some of the Irish cattle were extremely wide from hook to pin; 2) they would greatly improve testicles in the males... at the time, many Shorthorns had issues with twisted testicles and poor scrotum shape and 3) improve the frame and overall muscle structure of our cattle. I think the good Irish cattle that were imported did do this. Unfortunately, once the Irish craze started, most anything was imported here and some of them were not worth the trip over. Many others left a major mark on the breed.
Doc
Well-known member
Olson Family Shorthorns said:
It was kinda like when AQHA started registering horses , they had to meet breed standards they developed & if so they got a number.
The Gallloway deal would explain on Irish cattle , like Shannon Margie 027 (Black nose Margie) & other strong bred Improver lines where they got the occasional black noses or hairs.
TH was first described in Galloway cattle in 1951 in Scotland.
A 1976 survey of Galloway breeders showed that btwn 1-2% of purebred calves were affected and that 47% of breeders had had at least one TH calf
The Galloway breeders and association used test mating of carriers to eliminate the problem
There are no samples from TH Galloway calves so we will never know if the mutation in the Shorthorns is the same as in the Galloways
According to Harlan Ritchie Galloway was "infused" into the Shorthorns - not the other way around
I don't think that it is all that strange that the exact same defect would appear in more than one breed and we cannot assume the mutation is the same when it does
There is PHA in Dexters and the mutation is different from that in Maines. There is one documented case of PHA in a Hereford and it is not the same mutation as either Maines or Dexters
There is AM (formerly called curly calf) in Charolais and it is not known if it is the same mutation as the Angus
There is mule foot in many breeds with multiple mutations
aj, doc, shortdawg, red et al - been well, thanks for asking. Very cold long winter - calving in minus 15 with a 35 mph wind was not what I envisioned when I bred the cows! Today it is 65 - 3 days ago it was zero with a -20 wind chill -
The more we use AI and ET, the more we will increase the prevalence of recessive mutations in a population and the more defects we will see if we have our eyes open-
A 1976 survey of Galloway breeders showed that btwn 1-2% of purebred calves were affected and that 47% of breeders had had at least one TH calf
The Galloway breeders and association used test mating of carriers to eliminate the problem
There are no samples from TH Galloway calves so we will never know if the mutation in the Shorthorns is the same as in the Galloways
According to Harlan Ritchie Galloway was "infused" into the Shorthorns - not the other way around
I don't think that it is all that strange that the exact same defect would appear in more than one breed and we cannot assume the mutation is the same when it does
There is PHA in Dexters and the mutation is different from that in Maines. There is one documented case of PHA in a Hereford and it is not the same mutation as either Maines or Dexters
There is AM (formerly called curly calf) in Charolais and it is not known if it is the same mutation as the Angus
There is mule foot in many breeds with multiple mutations
aj, doc, shortdawg, red et al - been well, thanks for asking. Very cold long winter - calving in minus 15 with a 35 mph wind was not what I envisioned when I bred the cows! Today it is 65 - 3 days ago it was zero with a -20 wind chill -
The more we use AI and ET, the more we will increase the prevalence of recessive mutations in a population and the more defects we will see if we have our eyes open-
knabe
Well-known member
there is a way to see where it came from .
sample 384 individuals from each breed and see where the snps line up in those with lines that both are carriers, and free from carriers against lines with no carriers anywhere against galloway populations. you will see snps in the gene or other regions that indicate some snps came from whoever. snps don't disappear that fast.
sample 384 individuals from each breed and see where the snps line up in those with lines that both are carriers, and free from carriers against lines with no carriers anywhere against galloway populations. you will see snps in the gene or other regions that indicate some snps came from whoever. snps don't disappear that fast.
justintime
Well-known member
Dusty... I would suggest you start early on a Friday and make it a long weekend, just in case it is a little more complex an issue than anticipated. As for equipment, I think a good magnifying glass and a vivid imagination should be adequate to come up with some significant findings.
knabe
Well-known member
Dusty said:
no.
you don't need a microscope. it should be pretty easy to see what was in who. it would look something like this
gatcgaacacgtatcgatcgatcgatcgatgcataactgcctggcgcta gallowway
gatcgaacacgtatcgaacgatcgatcgatgcataactgcctggcgcta shorthorn thc
gatcgaacacgtatcgaacgatcgatcgatgcataactgcctggcgcta shorthorn thf from carrier line
gatcgaacacgtatcgaacgatcgatcgatgcataactgcatggcgcta shorthorn thf from free lines
gatcgaacacgtatcgatcgatcgatcgatgcataactgcatggcgcta other breed 1
gatcgaacacgtatcgatcgatcgatcgatgcataactgcatggcgcta other breed 2
basically what would happen, is that you would see more similarity between galloway and shorthorn than the others, and more similar areas in shorthorns and galloway that had linkage groups associated with TH assuming they really did mix and that the other breeds didn't have galloway in them, and if they did,they were different linkage groups than what caused the problem through introgression.
i didn't check the above too closely, so feel free to correct.
there would be lots of areas like these with reasonable similarity, more so than just any animal against the reference relatively linebred hereford that was used for the cattle genome project. basically
justintime
Well-known member
Thanks Knabe, you made it sound so simple!
Latest posts
-
-
-
-
Looking for info on the Grand Champion bull from the 1971 Buckeye Expo
- Latest: wannabcowguy
